Biol

Biol. is necessary for this. Active E2 association with the promoter was exhibited using chromatin immunoprecipitation assays. Electrophoretic mobility shift assays indicated that E2 interacted with a region 482 to 684 bp upstream of the transcription initiation site in vitro. This is the first time that HPV16 E2 has been Naloxegol Oxalate shown to regulate cellular gene expression and the first report of viral regulation of expression of an RNA processing factor. Such E2-mediated control during differentiation of infected epithelial cells may facilitate late capsid protein expression and completion of the computer virus life cycle. Human papillomavirus type 16 (HPV16) infects cervical F2rl1 epithelial cells, causing mainly benign lesions (cervical dysplasia). However, in some rare cases upon persistent contamination, lesions can progress to cervical cancer (66). The life cycle of this 7.9-kb double-stranded DNA virus is usually highly dependent upon the differentiation status of the epithelial tissue it infects. Of particular importance is usually restriction of expression of the highly immunogenic capsid proteins L1 and L2 to the most differentiated cells of the structure, where immune surveillance is usually low. However, while L1 and L2 RNAs have been detected in less-differentiated epithelial cells Naloxegol Oxalate (5, 60), fully processed messenger RNAs (mRNAs) are found only in differentiated epithelial cells (42), and capsid protein expression is restricted to the granular layer cells (48). Thus, expression of the computer virus capsid proteins is usually regulated at least partly at posttranscriptional levels (20). BL21(DE3)plysS. The SF2/ASF promoter was PCR amplified from HeLa cell genomic DNA from nt ?1024 to 25 of the transcriptional start site, using primers SF2pr ?1024 F and SF2pr +5 R (Table ?(Table1),1), and cloned into KpnI/SacI sites of pGCAT3-B (altered from pGL3-B [Promega] to replace the luciferase gene with a chloramphenicol acetyltransferase [CAT] reporter gene) to produce pGCAT3-B-SF2pr. Cells were transfected in 24-well plates using Lipofectamine 2000 (Invitrogen), following the manufacturer’s instructions. Cotransfection with pCMV-gal was used to control for transfection efficiency. After a 24-h incubation, cells were scraped into 30 l 0.25 M Tris, pH 7.5. Cell lysates were obtained by being freeze-thawed three times before cell debris was pelleted by centrifugation. The supernatant was harvested and stored at ?20C. TABLE 1. Primer sequences used for cloning, RT-PCR, ChIP assays, and EMSAs em a /em thead th colspan=”1″ rowspan=”1″ align=”center” valign=”bottom” Primer /th th colspan=”1″ rowspan=”1″ align=”center” valign=”bottom” Sequence /th th colspan=”1″ rowspan=”1″ align=”center” valign=”bottom” Application /th /thead SF2pr ?1024FGTTACGGTTCTCACATCCATTTTCGCloning of SF2pr EMSA probe 1SF2pr ?829 RTGACACTAGTGTGGGACTAGCGCAGAATGCEMSA probe 1SF2pr ?852 FTGACACTAGTCTTCATTAAGTACCGTTCCEMSA probe 2SF2pr ?650 RCAGGCATTCTGCGCTAGTCEMSA probe 2SF2pr ?684 FTGACACTAGTGTTCTGACGAGAAGGCGGAACEMSA probe 3SF2pr ?482 RGAAACCCGGGTATCTTCGTAGEMSA probe 3SF2pr ?524 FTGACACTAGTCAGCTCTGGATTAGACGCACChIP assays, EMSA probe 4SF2pr ?325 RGCAATGAGGATCTTTGAAAGCChIP assays, EMSA probe 4SF2pr ?402 FATGGTGGGACAACGCTTTAGEndogenous ChIP assaysSF2pr ?222 RTTTGCGAACAGAGTGACCAGEndogenous ChIP assaysSF2pr ?364 FTGACACTAGTCTTTGAAGGCGCCGAGTTGCEMSA probe 5SF2pr ?162 RGACGTCACCCTCCCCACGAAGEMSA probe 5SF2pr ?199 FTGACACTAGTGGGACTTTTTTACCCCCTTCEMSA probe 6SF2pr +5RCTCCCGCGGCCCCTCCAAAATGCloning of SF2pr EMSA probe 6CAT5 FAATCACTGGATATACCACCGTTGAChIP assaysCAT5 RTGAACGGTCTGGTTATAGGTACChIP assays5S RNA FGGCCATACCACCCTGAACGCChIP assays5S RNA RCAGCACCCGGTATTCCCAGGChIP assaysSF2 FCTCATCATTCCCCAGAAACCChIP assays, RT-PCRSF2 RGGCAGGAATCCACTCCTATGChIP assays, RT-PCRGAPDH FTCCACCACCCTGTTGCTGTART-PCRGAPDH RACCACAGTCCATGCCATCACRT-PCRCAT3 FCTGGCCTATTTCCCTAAAGGRT-PCRCAT3 RCAAACGGCATGATGAACCTGRT-PCR Open in a separate window aRestriction enzyme sites are underlined. F; forward primer, R; reverse primer. CAT assays. One to 20 l of lysate was added to a reaction mixture Naloxegol Oxalate of 625 M acetyl coenzyme A (Sigma), 0.05 Ci [14C]chloramphenicol, and 0.25 M Tris-HCl, pH 7.5, in a final volume of 40 l and incubated at 37C for 1 h. Two hundred microliters of ethyl acetate was added, and the solution was vortexed for 10 s before centrifugation at 13,000 rpm for 5 min at room temperature. The upper organic layer was transferred to a fresh tube and dried in an Eppendorf Concentrator 5301. Following resuspension in 25 l ethyl acetate, the solution was applied to a thin-layer chromatography plate (Sigma) and samples were separated in 95% chloroform, 5% methanol. Plates were visualized by phosphorimaging (Bio-Rad) and were analyzed using QuantityOne software. EMSAs. Probe DNA was PCR amplified from pGCAT3-B-SF2pr using SF2pr ?684 F and SF2pr ?482 R primers (Table ?(Table1)1) and digested with SpeI. DNA was purified from acrylamide gels by elution in 0.5 M NaCl, 1 mM EDTA at 4C overnight, followed by Naloxegol Oxalate ethanol precipitation. DNA was resuspended in 30 l distilled water and radiolabeled by incubation in 10 mM Tris-HCl, pH 7.9; 50 mM NaCl; 10 mM MgCl2; 1 mM dithiothreitol; 3.3 M dATP, dGTP, and dTTP; 2.5 U DNA polymerase I; large (Klenow) fragment (NEB); and 10 Ci [-32P]dCTP. Reactions Naloxegol Oxalate were carried out at room heat for 20 min, and then 3.3 M dCTP was added, followed by incubation for a further 5 min at room temperature. The probe was purified using a mini Quick Spin column (Roche), following the.